Stem-loop sequence cli-mir-19b-2

AccessionMI0029917 (change log)
DescriptionColumba livia miR-19b-2 stem-loop
Stem-loop
     g     a                 -  -      ucc    uuac 
5' ca ugcua uuacagucaguuuugca gg uuugca   cagc    u
   || ||||| ||||||||||||||||| || ||||||   ||||    a
3' gu guggu ggugucagucaaaacgu cc aaacgu   gucg    a
     g     -                 a  u      ---    uuaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375349.1: 3451977-3452067 [-]
intergenic
Clustered miRNAs
< 10kb from cli-mir-19b-2
cli-mir-106KB375349.1: 3452467-3452537 [-]
cli-mir-18bKB375349.1: 3452301-3452383 [-]
cli-mir-20bKB375349.1: 3452099-3452195 [-]
cli-mir-19b-2KB375349.1: 3451977-3452067 [-]
cli-mir-92-2KB375349.1: 3451812-3451895 [-]
cli-mir-363KB375349.1: 3451668-3451762 [-]
Database links

Mature sequence cli-miR-19b-2-5p

Accession MIMAT0038431
Sequence

18 - 

aguuuugcagguuugcaucccagc

 - 41

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-19b-3p

Accession MIMAT0038430
Sequence

55 - 

ugugcaaauccaugcaaaacuga

 - 77

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).