Stem-loop sequence cli-mir-20a

AccessionMI0029918 (change log)
DescriptionColumba livia miR-20a stem-loop
Stem-loop
   ------  u    c   -a                 ----g    g 
5'       cu guag acu  aagugcuuauagugcag     uagu u
         || |||| |||  |||||||||||||||||     ||||  
3'       ga cguc uga  uucacgaauauuacguc     auca u
   gauguc  u    a   aa                 aucua    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375488.1: 2837493-2837575 [-]
intergenic
Clustered miRNAs
< 10kb from cli-mir-20a
cli-mir-17KB375488.1: 2837957-2838047 [-]
cli-mir-18aKB375488.1: 2837808-2837898 [-]
cli-mir-19aKB375488.1: 2837667-2837754 [-]
cli-mir-20aKB375488.1: 2837493-2837575 [-]
cli-mir-19b-1KB375488.1: 2837364-2837438 [-]
cli-mir-92-1KB375488.1: 2837243-2837324 [-]
Database links

Mature sequence cli-miR-20a-5p

Accession MIMAT0038432
Sequence

11 - 

uaaagugcuuauagugcaggua

 - 32

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-20a-3p

Accession MIMAT0038433
Sequence

47 - 

acugcauuauaagcacuuaaagu

 - 69

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).