Stem-loop sequence cli-mir-21

AccessionMI0029920 (change log)
DescriptionColumba livia miR-21 stem-loop
Stem-loop
   ucc                a     a     a    ugg 
5'    ugucggauagcuuauc gacug uguug cugu   a
      |||||||||||||||| ||||| ||||| ||||    
3'    acagucugucggaugg cugac acaac ggua   u
   uuu                -     a     -    cuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375855.1: 434997-435074 [-]
intergenic
Database links

Mature sequence cli-miR-21-5p

Accession MIMAT0038436
Sequence

11 - 

uagcuuaucagacugauguuga

 - 32

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-21-3p

Accession MIMAT0038437
Sequence

50 - 

aacaacagucgguaggcuguc

 - 70

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).