Stem-loop sequence cli-mir-26-2

AccessionMI0029924 (change log)
DescriptionColumba livia miR-26-2 stem-loop
Stem-loop
   cag        c     uu         c           ugau  g 
5'    uggccggc ccagg  caaguaauc aggauaggcug    cu g
      |||||||| |||||  ||||||||| |||||||||||    ||  
3'    accggucg ggucu  guucauugg ucuuguccgac    ga g
   uag        a     cg         u           ---u  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375305.1: 1151281-1151373 [+]
intergenic
Database links

Mature sequence cli-miR-26-5p

Accession MIMAT0038442
Sequence

18 - 

uucaaguaauccaggauaggcu

 - 39

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-26-2-3p

Accession MIMAT0038444
Sequence

57 - 

ccuguucuugguuacuuggcuc

 - 78

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).