Stem-loop sequence cli-mir-27b

AccessionMI0029925 (change log)
DescriptionColumba livia miR-27b stem-loop
Stem-loop
   ---gcg                  auug        u  uug 
5'       aggugcagagcuuagcug    gugaacag ga   u
         ||||||||||||||||||    |||||||| ||   u
3'       uccacgucuugaaucggu    cacuuguu cu   u
   gaggag                  --ga        u  ccc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375520.1: 156995-157076 [+]
intergenic
Clustered miRNAs
< 10kb from cli-mir-27b
cli-mir-23bKB375520.1: 156759-156842 [+]
cli-mir-27bKB375520.1: 156995-157076 [+]
Database links

Mature sequence cli-miR-27b-5p

Accession MIMAT0038445
Sequence

10 - 

agagcuuagcugauuggugaaca

 - 32

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-27b-3p

Accession MIMAT0038446
Sequence

52 - 

uucacaguggcuaaguucugc

 - 72

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).