Stem-loop sequence cli-mir-29a-1

AccessionMI0029926 (change log)
DescriptionColumba livia miR-29a-1 stem-loop
Stem-loop
   agg            uuu       c    ucaa 
5'    augacugauuuc   ugguguu agag    u
      ||||||||||||   ||||||| ||||    a
3'    uauuggcuaaag   accacga ucuu    a
   uga            uuu       -    uuau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375423.1: 48226-48295 [-]
intergenic
Clustered miRNAs
< 10kb from cli-mir-29a-1
cli-mir-29b-1KB375423.1: 49398-49477 [-]
cli-mir-29a-1KB375423.1: 48226-48295 [-]
Database links

Mature sequence cli-miR-29a-5p

Accession MIMAT0038447
Sequence

7 - 

acugauuucuuuugguguucaga

 - 29

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-29a-3p

Accession MIMAT0038448
Sequence

45 - 

uagcaccauuugaaaucgguua

 - 66

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).