Stem-loop sequence cli-mir-29a-2

AccessionMI0029927 (change log)
DescriptionColumba livia miR-29a-2 stem-loop
Stem-loop
   aug         -  ggc           ucu       ---     uc 
5'    ucucuuaca ca   ugaccgauuuc   ugguguu   cagag  u
      ||||||||| ||   |||||||||||   |||||||   |||||  c
3'    gggggaugu gu   auuggcuaaag   accacga   guuuu  a
   aaa         a  ---           uuu       ucu     ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375734.1: 2207688-2207781 [-]
intergenic
Clustered miRNAs
< 10kb from cli-mir-29a-2
cli-mir-29b-2KB375734.1: 2208559-2208638 [-]
cli-mir-29a-2KB375734.1: 2207688-2207781 [-]
Database links

Mature sequence cli-miR-29a-3p

Accession MIMAT0038448
Sequence

58 - 

uagcaccauuugaaaucgguua

 - 79

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).