Stem-loop sequence cli-mir-29b-1

AccessionMI0029928 (change log)
DescriptionColumba livia miR-29b-1 stem-loop
Stem-loop
   cc       -          u      gu      uuaac 
5'   ucaggaa gcugguuuca auggug  uuagau     u
     ||||||| |||||||||| ||||||  ||||||     a
3'   gguucuu ugacuaaagu uaccac  gaucug     u
   ga       g          u      --      uuacu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375423.1: 49398-49477 [-]
intergenic
Clustered miRNAs
< 10kb from cli-mir-29b-1
cli-mir-29b-1KB375423.1: 49398-49477 [-]
cli-mir-29a-1KB375423.1: 48226-48295 [-]
Database links

Mature sequence cli-miR-29b-5p

Accession MIMAT0038449
Sequence

10 - 

gcugguuucauauggugguuuaga

 - 33

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-29b-3p

Accession MIMAT0038450
Sequence

51 - 

uagcaccauuugaaaucaguguu

 - 73

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).