Stem-loop sequence cli-mir-29b-2

AccessionMI0029929 (change log)
DescriptionColumba livia miR-29b-2 stem-loop
Stem-loop
   cc       -          c      g  u    uuucc 
5'   ucuggaa gcugguuuca auggug cu agau     c
     ||||||| |||||||||| |||||| || ||||     a
3'   ggaucuu ugacuaaagu uaccac ga ucua     c
   ga       g          u      -  -    uguuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375734.1: 2208559-2208638 [-]
intergenic
Clustered miRNAs
< 10kb from cli-mir-29b-2
cli-mir-29b-2KB375734.1: 2208559-2208638 [-]
cli-mir-29a-2KB375734.1: 2207688-2207781 [-]
Database links

Mature sequence cli-miR-29b-3p

Accession MIMAT0038450
Sequence

51 - 

uagcaccauuugaaaucaguguu

 - 73

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).