Stem-loop sequence cli-mir-30c-1

AccessionMI0029931 (change log)
DescriptionColumba livia miR-30c-1 stem-loop
Stem-loop
   guu    cac u       -    aca        ug gaa 
5'    guag   g guaaaca uccu   cucucagc  u   c
      ||||   | ||||||| ||||   ||||||||  |    
3'    cguc   c cauuugu agga   gagggucg  g   u
   uac    uuc u       u    ---        gu gag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375684.1: 335113-335192 [-]
intergenic
Clustered miRNAs
< 10kb from cli-mir-30c-1
cli-mir-30eKB375684.1: 336851-336934 [-]
cli-mir-30c-1KB375684.1: 335113-335192 [-]
Database links

Mature sequence cli-miR-30c-5p

Accession MIMAT0038453
Sequence

12 - 

uguaaacauccuacacucucagcu

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-30c-3p

Accession MIMAT0038454
Sequence

50 - 

cugggagaggauuguuuacucc

 - 71

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).