Stem-loop sequence cli-mir-30d

AccessionMI0029933 (change log)
DescriptionColumba livia miR-30d stem-loop
Stem-loop
     ug   c     u         ccc            uuc 
5' cg  guc ggugc guaaacauc   gacuggaagcug   c
   ||  ||| ||||| |||||||||   ||||||||||||    
3' gc  cgg ccacg cguuuguag   cugacuuucgac   c
     gu   u     u         --a            cug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375768.1: 3168624-3168705 [-]
intergenic
Database links

Mature sequence cli-miR-30d-5p

Accession MIMAT0038456
Sequence

14 - 

uguaaacauccccgacuggaagcu

 - 37

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-30d-3p

Accession MIMAT0038457
Sequence

50 - 

cuuucagucagauguuugcugc

 - 71

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).