Stem-loop sequence cli-mir-30e

AccessionMI0029934 (change log)
DescriptionColumba livia miR-30e stem-loop
Stem-loop
   guc                   uu           g gag  g 
5'    cuugcugcuguaaacaucc  gacuggaagcu u   gu c
      |||||||||||||||||||  ||||||||||| |   ||  
3'    ggacgacgacguuuguagg  cugacuuucga g   cg g
   guc                   --           g --a  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375684.1: 336851-336934 [-]
intergenic
Clustered miRNAs
< 10kb from cli-mir-30e
cli-mir-30eKB375684.1: 336851-336934 [-]
cli-mir-30c-1KB375684.1: 335113-335192 [-]
Database links

Mature sequence cli-miR-30e-5p

Accession MIMAT0038458
Sequence

12 - 

uguaaacauccuugacuggaagcu

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-30e-3p

Accession MIMAT0038459
Sequence

54 - 

cuuucagucggauguuugcagc

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).