Stem-loop sequence cli-mir-31

AccessionMI0029935 (change log)
DescriptionColumba livia miR-31 stem-loop
Stem-loop
   ugu      cu      ga     g             uguagac 
5'    gcagag  ggaggg  ggcaa auguuggcauagc       c
      ||||||  ||||||  ||||| |||||||||||||       u
3'    ugucuc  ccuuuc  cuguu uacaaccguaucg       a
   guu      -u      ua     a             uccaaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375742.1: 622302-622393 [+]
intergenic
Database links

Mature sequence cli-miR-31-5p

Accession MIMAT0038460
Sequence

19 - 

aggcaagauguuggcauagcugu

 - 41

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-31-3p

Accession MIMAT0038461
Sequence

55 - 

ugcuaugccaacauauugucauc

 - 77

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).