Stem-loop sequence cli-mir-33-1

AccessionMI0029937 (change log)
DescriptionColumba livia miR-33-1 stem-loop
Stem-loop
   ccu     g ag     g          uu         -    ug 
5'    gggug c  cugua ugcauuguag  gcauugcau guug  g
      ||||| |  ||||| ||||||||||  ||||||||| ||||   
3'    cucac g  gacau acgugacguc  uguaacgug caau  c
   --u     - ga     g          cu         u    ga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB376364.1: 144822-144911 [-]
intergenic
Database links

Mature sequence cli-miR-33-5p

Accession MIMAT0038464
Sequence

18 - 

gugcauuguaguugcauugca

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-33-3p

Accession MIMAT0038465
Sequence

58 - 

caauguuccugcagugcagua

 - 78

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).