Stem-loop sequence cli-mir-34b

AccessionMI0029940 (change log)
DescriptionColumba livia miR-34b stem-loop
Stem-loop
   ---      -gg    ua       u   -   c       aacca 
5'    gugcuu   uuug  ggcagug agu uag ugauugu     c
      ||||||   ||||  ||||||| ||| ||| |||||||      
3'    cacgga   aaac  ccgucac uca auc acuaacg     u
   gga      aca    ua       -   c   -       ccucg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375352.1: 2053022-2053108 [+]
intergenic
Clustered miRNAs
< 10kb from cli-mir-34b
cli-mir-34bKB375352.1: 2053022-2053108 [+]
cli-mir-34cKB375352.1: 2053395-2053477 [+]
Database links

Mature sequence cli-miR-34b-5p

Accession MIMAT0038469
Sequence

14 - 

aggcaguguaguuagcugauugu

 - 36

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-34b-3p

Accession MIMAT0038470
Sequence

51 - 

aaucacuacacucacugccauc

 - 72

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).