Stem-loop sequence cli-mir-96

AccessionMI0029944 (change log)
DescriptionColumba livia miR-96 stem-loop
Stem-loop
   ----------gg     u         g     uu      u  uuu 
5'             cccgu uuggcacua cacau  uugcuu ga   g
               ||||| ||||||||| |||||  |||||| ||   u
3'             gggua aaccgugau gugua  aacgag uu   a
   agaggcggaaga     u         -     uu      u  ucg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375435.1: 1261705-1261790 [+]
intergenic
Clustered miRNAs
< 10kb from cli-mir-96
cli-mir-183KB375435.1: 1261576-1261666 [+]
cli-mir-96KB375435.1: 1261705-1261790 [+]
cli-mir-182KB375435.1: 1262243-1262337 [+]
Database links

Mature sequence cli-miR-96-5p

Accession MIMAT0038476
Sequence

8 - 

uuuggcacuagcacauuuuugcu

 - 30

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-96-3p

Accession MIMAT0038477
Sequence

50 - 

caauuauguguagugccaauau

 - 71

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).