Stem-loop sequence cli-mir-101-2

AccessionMI0029948 (change log)
DescriptionColumba livia miR-101-2 stem-loop
Stem-loop
   acu   -a  ug  c                    cg     guaua 
5'    aug  ac  uc uuuuucgguuaucaugguac  gugcu     c
      |||  ||  || ||||||||||||||||||||  |||||      
3'    uac  ug  gg aagaagucaauagugucaug  caugg     g
   cac   cg  gu  u                    -a     aaagu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375318.1: 3523017-3523110 [-]
intergenic
Database links

Mature sequence cli-miR-101-2-5p

Accession MIMAT0038484
Sequence

19 - 

ucgguuaucaugguaccggugcu

 - 41

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-101-3p

Accession MIMAT0038483
Sequence

56 - 

uacaguacugugauaacugaa

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).