Stem-loop sequence cli-mir-107

AccessionMI0029952 (change log)
DescriptionColumba livia miR-107 stem-loop
Stem-loop
   guguucu  u      --c    u  u           c   u   a 
5'        cu ugcuuu   agcu cu uacaguguugc uug ggc u
          || ||||||   |||| || ||||||||||| ||| ||| g
3'        gg acgaaa   ucgg ga auguuacgacg aac uug g
   -------  u      cua    -  c           -   -   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375396.1: 365360-365444 [-]
intergenic
Database links

Mature sequence cli-miR-107-5p

Accession MIMAT0038489
Sequence

18 - 

agcuucuuuacaguguugccuug

 - 40

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-107-3p

Accession MIMAT0038490
Sequence

55 - 

agcagcauuguacagggcuau

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).