Stem-loop sequence cli-mir-122

AccessionMI0029953 (change log)
DescriptionColumba livia miR-122 stem-loop
Stem-loop
   ---     c -      gg       c           --u  c 
5'    cugcc g agcugu  aguguga aaugguguuug   gu c
      ||||| | ||||||  ||||||| |||||||||||   ||  
3'    gaugg c ucgaua  ucacacu uuaccgcaaac   cg u
   aca     u a      aa       a           uau  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB376610.1: 24141-24224 [+]
intergenic
Database links

Mature sequence cli-miR-122-5p

Accession MIMAT0038491
Sequence

13 - 

uggagugugacaaugguguuug

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-122-3p

Accession MIMAT0038492
Sequence

49 - 

aacgccauuaucacacuaaaua

 - 70

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).