Stem-loop sequence cli-mir-124-1

AccessionMI0029954 (change log)
DescriptionColumba livia miR-124-1 stem-loop
Stem-loop
   cca   c    a    cc        a   ga        uaau 
5'    agg ucug cucu  guguucac gcg  ccuugauu    g
      ||| |||| ||||  |||||||| |||  ||||||||    u
3'    ucc aggc gaga  cguaagug cgc  ggaauuaa    c
   aac   u    -    ac        g   ac        caua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375514.1: 1203206-1203295 [-]
intergenic
Database links

Mature sequence cli-miR-124-5p

Accession MIMAT0038493
Sequence

18 - 

cguguucacagcggaccuuga

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-124-3p

Accession MIMAT0038494
Sequence

55 - 

uaaggcacgcggugaaugccaa

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).