Stem-loop sequence cli-mir-124-2

AccessionMI0029955 (change log)
DescriptionColumba livia miR-124-2 stem-loop
Stem-loop
   ccc   - c       - c        a   ga        uaaug 
5'    gag c ccucucu g guguucac gcg  ccuugauu     u
      ||| | ||||||| | |||||||| |||  ||||||||      
3'    cuc g ggagaga c cguaagug cgc  ggaauuaa     c
   aca   c a       a -        g   ac        cauac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375315.1: 2496168-2496258 [-]
intergenic
Database links

Mature sequence cli-miR-124-2-5p

Accession MIMAT0038495
Sequence

17 - 

cguguucacagcggaccuugau

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-124-3p

Accession MIMAT0038494
Sequence

55 - 

uaaggcacgcggugaaugccaa

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).