Stem-loop sequence cli-mir-125-1

AccessionMI0029956 (change log)
DescriptionColumba livia miR-125-1 stem-loop
Stem-loop
   guu    cc   u  -a    u    c           au        
5'    gcgc  cuc ca  uccc gaga ccuaacuugug  guuuagc 
      ||||  ||| ||  |||| |||| |||||||||||  |||||| u
3'    cgug  gag gu  aggg uucu ggauugggcac  uaaauuu 
   uuu    uu   u  cg    -    c           -c        
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375651.1: 846253-846344 [-]
intergenic
Database links

Mature sequence cli-miR-125-5p

Accession MIMAT0038496
Sequence

17 - 

ucccugagacccuaacuuguga

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-125-3p

Accession MIMAT0038497
Sequence

57 - 

acggguuaggcucuugggagcu

 - 78

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).