Stem-loop sequence cli-mir-125-2

AccessionMI0029957 (change log)
DescriptionColumba livia miR-125-2 stem-loop
Stem-loop
   gga   uu     uc  ug   c   a        ----g   u 
5'    cuu  ccuag  cc  aga ccu acuuguga     guu u
      |||  |||||  ||  ||| ||| ||||||||     |||  
3'    gag  ggauc  gg  ucu gga ugaacacu     cga u
   ggg   gc     ca  gu   c   c        aacaa   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375804.1: 18463414-18463499 [+]
intergenic
Database links

Mature sequence cli-miR-125-5p

Accession MIMAT0038496
Sequence

14 - 

ucccugagacccuaacuuguga

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-125-2-3p

Accession MIMAT0038498
Sequence

54 - 

acaagucaggcucuugggaccu

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).