Stem-loop sequence cli-mir-126

AccessionMI0029958 (change log)
DescriptionColumba livia miR-126 stem-loop
Stem-loop
   acc      g     c           u       c cug   c 
5'    gcuggu acggc cauuauuacuu ugguacg g   uga a
      |||||| ||||| ||||||||||| ||||||| |   |||  
3'    cgaccg ugucg guaauaaugag gccaugc c   acu c
   gca      g     c           u       u -aa   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375962.1: 1958252-1958340 [-]
intergenic
Database links

Mature sequence cli-miR-126-5p

Accession MIMAT0038499
Sequence

17 - 

cauuauuacuuuugguacgcgc

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-126-3p

Accession MIMAT0038500
Sequence

54 - 

ucguaccgugaguaauaaugcg

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).