Stem-loop sequence cli-mir-128-2

AccessionMI0029960 (change log)
DescriptionColumba livia miR-128-2 stem-loop
Stem-loop
    ug   cu             uua      aa    g gag 
5' g  cag  ggaaggggggccg   cacugu  gaga u   u
   |  |||  |||||||||||||   ||||||  |||| |    
3' u  guc  ccuuuucucuggc   gugaca  cucu g   a
    gu   au             caa      --    g acg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375337.1: 1465295-1465376 [-]
intergenic
Database links

Mature sequence cli-miR-128-5p

Accession MIMAT0038502
Sequence

14 - 

gggggccguuacacuguaaga

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-128-3p

Accession MIMAT0038501
Sequence

51 - 

ucacagugaaccggucucuuu

 - 71

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).