Stem-loop sequence cli-mir-130c

AccessionMI0029963 (change log)
DescriptionColumba livia miR-130c stem-loop
Stem-loop
   gug      u    a        uc         a  g -  a 
5'    cuguug ccag gcccuuuu  uguuguacu cu g ca u
      |||||| |||| ||||||||  ||||||||| || | ||  
3'    gacggu gguu cgggaaaa  auaacguga ga u gu u
   aaa      c    a        uu         c  g a  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB376592.1: 505475-505561 [-]
intergenic
Clustered miRNAs
< 10kb from cli-mir-130c
cli-mir-130cKB376592.1: 505475-505561 [-]
cli-mir-301bKB376592.1: 504205-504294 [-]
cli-mir-454KB376592.1: 497716-497804 [-]
Database links

Mature sequence cli-miR-130c-5p

Accession MIMAT0038507
Sequence

16 - 

gcccuuuuucuguuguacuacu

 - 37

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-130c-3p

Accession MIMAT0038508
Sequence

53 - 

cagugcaauauuaaaagggcau

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).