Stem-loop sequence cli-mir-133a-1

AccessionMI0029964 (change log)
DescriptionColumba livia miR-133a-1 stem-loop
Stem-loop
   cuc      uuu    a       aa  u  a        accuc 
5'    caaugc   gcua agcuggu  aa gg accaaauc     u
      ||||||   |||| |||||||  || || ||||||||      
3'    guuacg   cgau ucgacca  uu cc ugguuuag     u
   cua      uau    g       ac  c  c        guaac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375298.1: 295624-295715 [-]
intergenic
Clustered miRNAs
< 10kb from cli-mir-133a-1
cli-mir-1a-2KB375298.1: 298704-298792 [-]
cli-mir-133a-1KB375298.1: 295624-295715 [-]
Database links

Mature sequence cli-miR-133a-5p

Accession MIMAT0038509
Sequence

18 - 

agcugguaaaauggaaccaaauc

 - 40

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-133a-3p

Accession MIMAT0038510
Sequence

55 - 

uuugguccccuucaaccagcugu

 - 77

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).