Stem-loop sequence cli-mir-133b

AccessionMI0029966 (change log)
DescriptionColumba livia miR-133b stem-loop
Stem-loop
   uau  u     c        ca  c  a        ca   u 
5'    gc cugcu uggcuggu  aa gg accaagcc  ucu c
      || ||||| ||||||||  || || ||||||||  ||| c
3'    ug gacga aucgacca  uu cc ugguuugg  agg u
   agu  u     u        ac  c  c        --   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375390.1: 6645-6729 [+]
intergenic
Clustered miRNAs
< 10kb from cli-mir-133b
cli-mir-206KB375390.1: 1979-2064 [+]
cli-mir-133bKB375390.1: 6645-6729 [+]
Database links

Mature sequence cli-miR-133b-5p

Accession MIMAT0038511
Sequence

15 - 

gcuggucaaacggaaccaagcc

 - 36

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-133b-3p

Accession MIMAT0038512
Sequence

52 - 

uuugguccccuucaaccagcua

 - 73

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).