Stem-loop sequence cli-mir-133c

AccessionMI0029967 (change log)
DescriptionColumba livia miR-133c stem-loop
Stem-loop
   aug       c   g       aaa    -a        aacuu 
5'    gugcguc cug ggcuggu   aagg  accagauc     g
      ||||||| ||| |||||||   ||||  ||||||||      
3'    uacgcgg gac ucgacca   uucc  ugguuuag     c
   gug       c   g       -ac    cc        gucaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375684.1: 950877-950964 [-]
intergenic
Clustered miRNAs
< 10kb from cli-mir-133c
cli-mir-1bKB375684.1: 951010-951095 [-]
cli-mir-133cKB375684.1: 950877-950964 [-]
Database links

Mature sequence cli-miR-133c-3p

Accession MIMAT0038513
Sequence

53 - 

uuugguccccuucaaccagcugc

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).