Stem-loop sequence cli-mir-135-2

AccessionMI0029969 (change log)
DescriptionColumba livia miR-135-2 stem-loop
Stem-loop
   cua                u            u g a 
5'    guguuuuauggcuuuu auuccuauguga a u a
      |||||||||||||||| |||||||||||| | | u
3'    cauaaaguaccgaagg uagggauguacu u a a
   uua                -            c g a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375832.1: 971008-971083 [-]
intergenic
Database links

Mature sequence cli-miR-135-5p

Accession MIMAT0038514
Sequence

10 - 

uauggcuuuuuauuccuauguga

 - 32

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-135-2-3p

Accession MIMAT0038516
Sequence

48 - 

auguagggauggaagccaugaa

 - 69

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).