Stem-loop sequence cli-mir-137a

AccessionMI0029971 (change log)
DescriptionColumba livia miR-137a stem-loop
Stem-loop
   cug           ug   g           ug a     -  g 
5'    acucucuucgg  acg guauucuuggg  g uaaua cg a
      |||||||||||  ||| |||||||||||  | ||||| || u
3'    ugagaggagcu  ugc cauaagaauuc  u auugu gc u
   cca           ga   g           gu -     u  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375307.1: 3584703-3584791 [-]
intergenic
Database links

Mature sequence cli-miR-137a-5p

Accession MIMAT0038518
Sequence

17 - 

acggguauucuuggguggauaau

 - 39

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-137a-3p

Accession MIMAT0038519
Sequence

53 - 

uuauugcuuaagaauacgcguag

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).