Stem-loop sequence cli-mir-138-1

AccessionMI0029973 (change log)
DescriptionColumba livia miR-138-1 stem-loop
Stem-loop
   uca     c    a  ag             uca      - a  a 
5'    ggugc gugc gc  cugguguugugaa   ggccgu c cc g
      ||||| |||| ||  |||||||||||||   |||||| | ||  
3'    ccacg cacg ug  gaccacaacacuu   ucggca g gg u
   aca     c    c  -g             -ca      a a  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375704.1: 712496-712586 [+]
intergenic
Database links

Mature sequence cli-miR-138-5p

Accession MIMAT0038522
Sequence

17 - 

agcugguguugugaaucaggccg

 - 39

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-138-3p

Accession MIMAT0038523
Sequence

57 - 

gcuacuucacaacaccagggu

 - 77

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).