Stem-loop sequence cli-mir-138-2

AccessionMI0029974 (change log)
DescriptionColumba livia miR-138-2 stem-loop
Stem-loop
   ccc     u     u  ag       u     uca     acgacaagcg 
5'    gguau ggugc gc  cuggugu gugaa   ggccg          c
      ||||| ||||| ||  ||||||| |||||   |||||           
3'    ccaua cuacg ug  gaccaca cacuu   ucggc          a
   -ca     -     u  -g       u     -ua     cuaucauccu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375448.1: 10794987-10795084 [+]
intergenic
Database links

Mature sequence cli-miR-138-5p

Accession MIMAT0038522
Sequence

18 - 

agcugguguugugaaucaggccg

 - 40

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-138-2-3p

Accession MIMAT0038524
Sequence

65 - 

gcuauuucacuacaccagggu

 - 85

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).