Stem-loop sequence cli-mir-139

AccessionMI0029975 (change log)
DescriptionColumba livia miR-139 stem-loop
Stem-loop
   cca  -     c   -      -   u  a            guga 
5'    gg ccugg ugu auucua cag gc ugugucuccagu    g
      || ||||| ||| |||||| ||| || ||||||||||||    u
3'    cc gggcc aca uaaggu guc cg acguagagguca    a
   aca  a     a   a      u   c  -            guga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB376564.1: 18329-18419 [+]
intergenic
Database links

Mature sequence cli-miR-139-5p

Accession MIMAT0038525
Sequence

17 - 

ucuacagugcaugugucuccagu

 - 39

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-139-3p

Accession MIMAT0038526
Sequence

53 - 

uggagaugcagcccuguuggaau

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).