Stem-loop sequence cli-mir-142

AccessionMI0029977 (change log)
DescriptionColumba livia miR-142 stem-loop
Stem-loop
   gag        g   c           a         u aa a    
5'    acagugca uca ccauaaaguag aagcacuac a  c gca 
      |||||||| ||| ||||||||||| ||||||||| |  | || c
3'    ugucaugu agu gguauuucauc uuugugaug u  g cgu 
   ggg        g   a           c         - gg a    
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375567.1: 47087-47178 [+]
intergenic
Database links

Mature sequence cli-miR-142-5p

Accession MIMAT0038529
Sequence

18 - 

cauaaaguagaaagcacuacu

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-142-3p

Accession MIMAT0038530
Sequence

57 - 

uaguguuuccuacuuuaugga

 - 77

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).