Stem-loop sequence cli-mir-146a

AccessionMI0029980 (change log)
DescriptionColumba livia miR-146a stem-loop
Stem-loop
   cgu      uc    uu         a           -guaau  a 
5'    guauuc  agcu  gagaacuga uuccauggguu      ug a
      ||||||  ||||  ||||||||| |||||||||||      ||  
3'    uauagg  ucga  uucuugacu gggguacccag      gc u
   cuu      -u    -c         c           acuguc  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375405.1: 8894965-8895057 [+]
intergenic
Database links

Mature sequence cli-miR-146a-5p

Accession MIMAT0038535
Sequence

17 - 

ugagaacugaauuccauggguug

 - 39

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-146a-3p

Accession MIMAT0038536
Sequence

59 - 

acccauggggcucaguucuuca

 - 80

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).