Stem-loop sequence cli-mir-146c

AccessionMI0029982 (change log)
DescriptionColumba livia miR-146c stem-loop
Stem-loop
   guu  c    cu           u           uuc  gu 
5'    cc agcu  gagaacugaau ccauggacugg   ca  u
      || ||||  ||||||||||| |||||||||||   ||   
3'    gg ucga  cucuugacuua gguaccugacu   gu  c
   guc  u    -u           u           ugu  ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375512.1: 1412182-1412266 [-]
intergenic
Database links

Mature sequence cli-miR-146c-5p

Accession MIMAT0038539
Sequence

12 - 

ugagaacugaauuccauggacug

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-146c-3p

Accession MIMAT0038540
Sequence

55 - 

guccaugguauucaguucucuag

 - 77

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).