Stem-loop sequence cli-mir-148a

AccessionMI0029984 (change log)
DescriptionColumba livia miR-148a stem-loop
Stem-loop
   gga   u     ag            --a    cc    -   gg 
5'    gcc ccgga  caaaguucugug   cacu  gacu cug  u
      ||| |||||  ||||||||||||   ||||  |||| |||  a
3'    cgg ggccu  guuucaagacau   guga  cuga gau  c
   ---   c     cu            cac    --    c   ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB376037.1: 533815-533899 [-]
intergenic
Database links

Mature sequence cli-miR-148a-5p

Accession MIMAT0038542
Sequence

16 - 

aaaguucugugacacuccgacu

 - 37

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-148a-3p

Accession MIMAT0038543
Sequence

54 - 

ucagugcacuacagaacuuugu

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).