Stem-loop sequence cli-mir-153a

AccessionMI0029986 (change log)
DescriptionColumba livia miR-153a stem-loop
Stem-loop
   ucu   a          -              -       --   aa 
5'    cgc gcugccggcg ucauuuuugugauu ugcagcu  agu  u
      ||| |||||||||| |||||||||||||| |||||||  |||   
3'    gug cgacgguugc agugaaaacacuga acguuga  ucg  c
   ucc   c          u              u       cc   gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375305.1: 1622007-1622098 [-]
intergenic
Database links

Mature sequence cli-miR-153a-5p

Accession MIMAT0038545
Sequence

18 - 

ucauuuuugugauuugcagcu

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-153a-3p

Accession MIMAT0038546
Sequence

55 - 

uugcauagucacaaaagugauc

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).