Stem-loop sequence cli-mir-155

AccessionMI0029988 (change log)
DescriptionColumba livia miR-155 stem-loop
Stem-loop
   ugu    -  -   gu             c   a        -u   c 
5'    aggc ug uau  uguuaaugcuaau gug uagggguu  uua c
      |||| || |||  ||||||||||||| ||| ||||||||  |||  
3'    uccg ac aug  acaauuacgauua uac auccucag  agu u
   uuc    u  u   uc             -   -        uc   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375804.1: 7953867-7953959 [-]
intergenic
Database links

Mature sequence cli-miR-155-5p

Accession MIMAT0038549
Sequence

17 - 

uuaaugcuaaucgugauaggggu

 - 39

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).