Stem-loop sequence cli-mir-181a-1

AccessionMI0029989 (change log)
DescriptionColumba livia miR-181a-1 stem-loop
Stem-loop
   -ugua      -   uc  u a   u      cu       a    gga  u 
5'      gugguu gcu  ag g aca ucaacg  gucggug guuu   au a
        |||||| |||  || | ||| ||||||  ||||||| ||||   ||  
3'      uaccaa cga  uc c ugu aguugc  cagcuac caaa   ug a
   ccucc      u   cc  c a   u      --       -    -ag  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375307.1: 7344736-7344835 [+]
intergenic
Clustered miRNAs
< 10kb from cli-mir-181a-1
cli-mir-181a-1KB375307.1: 7344736-7344835 [+]
cli-mir-181b-1KB375307.1: 7344927-7345011 [+]
Database links

Mature sequence cli-miR-181a-5p

Accession MIMAT0038550
Sequence

20 - 

aacauucaacgcugucggugaguu

 - 43

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-181a-3p

Accession MIMAT0038551
Sequence

60 - 

accaucgaccguugauuguacc

 - 81

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).