Stem-loop sequence cli-mir-181b-2

AccessionMI0029992 (change log)
DescriptionColumba livia miR-181b-2 stem-loop
Stem-loop
   cuaa   -     aucaa         cu           uu uu 
5'     ugg cugca     cauucauug  gucgguggguu  c  u
       ||| |||||     |||||||||  |||||||||||  |   
3'     acc ggcgu     guaaguaac  uagucacucaa  g  u
   -ccg   a     caaac         --           cu uc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375970.1: 918296-918383 [-]
intergenic
Clustered miRNAs
< 10kb from cli-mir-181b-2
cli-mir-181a-2KB375970.1: 919211-919310 [-]
cli-mir-181b-2KB375970.1: 918296-918383 [-]
Database links

Mature sequence cli-miR-181b-5p

Accession MIMAT0038553
Sequence

16 - 

aacauucauugcugucgguggguu

 - 39

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-181b-2-3p

Accession MIMAT0038555
Sequence

54 - 

cucacugaucaaugaaugcaaa

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).