Stem-loop sequence cli-mir-182

AccessionMI0029993 (change log)
DescriptionColumba livia miR-182 stem-loop
Stem-loop
   cgg           cuu       u -g      uca      ----   g 
5'    ccccggggcug   uuggcaa g  uagaac   cacugg    ugc g
      |||||||||||   ||||||| |  ||||||   ||||||    |||  
3'    ggggccccgac   aaccguu c  aucuug   guggcc    acg u
   gag           auc       - ag      ---      uagg   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375435.1: 1262243-1262337 [+]
intergenic
Clustered miRNAs
< 10kb from cli-mir-182
cli-mir-183KB375435.1: 1261576-1261666 [+]
cli-mir-96KB375435.1: 1261705-1261790 [+]
cli-mir-182KB375435.1: 1262243-1262337 [+]
Database links

Mature sequence cli-miR-182-5p

Accession MIMAT0038556
Sequence

17 - 

uuuggcaaugguagaacucacacu

 - 40

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-182-3p

Accession MIMAT0038557
Sequence

61 - 

ugguucuagacuugccaacu

 - 80

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).