Stem-loop sequence cli-mir-184

AccessionMI0029995 (change log)
DescriptionColumba livia miR-184 stem-loop
Stem-loop
   ggc     u   cu        c      a c     uucuuc 
5'    cauuc cau  ccuuauca uuuucc g ccagc      a
      ||||| |||  |||||||| |||||| | |||||      c
3'    gugag gua  ggaauagu aagagg c gguug      u
   aca     c   ug        c      - a     ucaaug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375795.1: 3395653-3395740 [-]
intergenic
Database links

Mature sequence cli-miR-184-5p

Accession MIMAT0038560
Sequence

15 - 

ccuuaucacuuuuccagcccagc

 - 37

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-184-3p

Accession MIMAT0038561
Sequence

55 - 

uggacggagaacugauaagggu

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).