Stem-loop sequence cli-mir-187

AccessionMI0029996 (change log)
DescriptionColumba livia miR-187 stem-loop
Stem-loop
   uau    aga    c    a                a c  u 
5'    ugug   ccuc ggcu caacacaggacauggg g uu u
      ||||   |||| |||| |||||||||||||||| | ||  
3'    acac   ggag ccga guuguguucugugcuc c ag c
   ucu    -gg    a    c                c a  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375503.1: 68256-68340 [+]
intergenic
Database links

Mature sequence cli-miR-187-5p

Accession MIMAT0038562
Sequence

17 - 

gcuacaacacaggacaugggag

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-187-3p

Accession MIMAT0038563
Sequence

52 - 

ucgugucuuguguugcagcca

 - 72

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).