Stem-loop sequence cli-mir-194

AccessionMI0029999 (change log)
DescriptionColumba livia miR-194 stem-loop
Stem-loop
   cau   c   c     u         a      g    cuac 
5'    ggg gcu ucaga guaacagca cuccau ugga    a
      ||| ||| ||||| ||||||||| |||||| ||||    c
3'    cuc cga aguuu cauugucgu gaggug accu    u
   acu   -   u     u         a      -    ucag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375331.1: 1524707-1524791 [-]
intergenic
Clustered miRNAs
< 10kb from cli-mir-194
cli-mir-194KB375331.1: 1524707-1524791 [-]
cli-mir-215KB375331.1: 1524393-1524481 [-]
Database links

Mature sequence cli-miR-194-5p

Accession MIMAT0038568
Sequence

17 - 

uguaacagcaacuccauguggac

 - 39

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-194-3p

Accession MIMAT0038569
Sequence

51 - 

ccaguggagaugcuguuacuuu

 - 72

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).