Stem-loop sequence cli-mir-196-1

AccessionMI0030000 (change log)
DescriptionColumba livia miR-196-1 stem-loop
Stem-loop
   cucu                c     g   ggcuuuua 
5'     gugaauuagguaguuu auguu uug        a
       |||||||||||||||| ||||| |||         
3'     cauuuaguccaucaaa uacaa aac        u
   -ccu                c     g   acaaauuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375599.1: 1508605-1508681 [+]
intergenic
Database links

Mature sequence cli-miR-196-5p

Accession MIMAT0038570
Sequence

11 - 

uagguaguuucauguuguuggg

 - 32

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-196-3p

Accession MIMAT0038571
Sequence

49 - 

caagaacaucaaacuaccugau

 - 70

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).