Stem-loop sequence cli-mir-196-2

AccessionMI0030001 (change log)
DescriptionColumba livia miR-196-2 stem-loop
Stem-loop
   -u  -       cu      u          a          a   g 
5'   gc agcugau  gugguu agguaguuuc uguuguuggg uug c
     || |||||||  |||||| |||||||||| |||||||||| ||| u
3'   ug uugacug  cauuaa uccgucaaag acaacggcuc gau u
   uc  a       --      u          a          -   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB376284.1: 197727-197818 [+]
intergenic
Database links

Mature sequence cli-miR-196-5p

Accession MIMAT0038570
Sequence

19 - 

uagguaguuucauguuguuggg

 - 40

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).