Stem-loop sequence cli-mir-200b

AccessionMI0030006 (change log)
DescriptionColumba livia miR-200b stem-loop
Stem-loop
   ccu          uac    -    ug     c      uguuu 
5'    gagaugccau   cauc uuac  ggcag auugga     u
      ||||||||||   |||| ||||  ||||| ||||||     c
3'    cuuuguggua   guag aaug  ccguc uaaucu     u
   gug          uua    u    gu     a      uucug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB376210.1: 2377070-2377159 [+]
intergenic
Clustered miRNAs
< 10kb from cli-mir-200b
cli-mir-200bKB376210.1: 2377070-2377159 [+]
cli-mir-200aKB376210.1: 2379399-2379493 [+]
cli-mir-429KB376210.1: 2382074-2382167 [+]
Database links

Mature sequence cli-miR-200b-5p

Accession MIMAT0038577
Sequence

17 - 

caucuuacugggcagcauugga

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-200b-3p

Accession MIMAT0038578
Sequence

54 - 

uaauacugccugguaaugaugau

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).