Stem-loop sequence cli-mir-202

AccessionMI0030007 (change log)
DescriptionColumba livia miR-202 stem-loop
Stem-loop
   uga   -        u           -a   a       g   au 
5'    cuc guuguucc uuuuccuaugc  uau cuucuuu aga  u
      ||| |||||||| |||||||||||  ||| ||||||| |||   
3'    gag cagcgggg aaaaggguacg  aua ggagaaa ucu  u
   aug   u        u           gg   c       -   ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375535.1: 1438264-1438354 [+]
intergenic
Database links

Mature sequence cli-miR-202-5p

Accession MIMAT0038579
Sequence

18 - 

uuccuaugcauauacuucuuu

 - 38

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).